# -*- mode: Yaml; -*-
# Timestamp: 2016-11-17T10:14:13.572175
#
# Default options.
# Can also be specific for a set of samples, libraries, and lanes,
# by including the "Options" hierarchy at the same level as those
# samples, libraries, or lanes . This does not include
# "Features", which may only be specific globally.
Options:
  Platform: Illumina
  QualityOffset: 33

  # Settings for trimming of reads, see AdapterRemoval man-page
  AdapterRemoval:
     # Adapter sequences, set and uncomment to override defaults
#     --adapter1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
#     --adapter2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
     # Some BAM pipeline defaults differ from AR defaults;
     # To override, change these value(s):
     --mm: 3
     --minlength: 30
     # Extra features enabled by default; change 'yes' to 'no' to disable
     --collapse: yes
     --trimns: yes
     --trimqualities: yes

  # Settings for aligners supported by the pipeline
  Aligners:
    # Choice of aligner software to use, either "BWA" or "Bowtie2"
    Program: BWA

    # Settings for mappings performed using BWA
    BWA:
      # One of "backtrack", "bwasw", or "mem"; see the BWA documentation
      # for a description of each algorithm (defaults to 'backtrack')
      Algorithm: backtrack
      # Filter aligned reads with a mapping quality (Phred)  this value
      MinQuality: 30
      # Filter reads that did not map to the reference sequence
      FilterUnmappedReads: yes
      # May be disabled ("no") for aDNA alignments, as post-mortem damage
      # localizes to the seed region, which BWA expects to have few
      # errors (sets "-l"). See http://pmid.us/22574660
      UseSeed: no
      # Additional command-line options may be specified for the "aln"
      # call(s), as described  for Bowtie2 .

    # Settings for mappings performed using Bowtie2
    Bowtie2:
      # Filter aligned reads with a mapping quality (Phred)  this value
      MinQuality: 0
      # Filter reads that did not map to the reference sequence
      FilterUnmappedReads: yes
      # Examples of how to add additional command-line options
#      --trim5: 5
#      --trim3: 5
      # Note that the colon is required, even if no value is specified
      --very-sensitive:
      # Example of how to specify multiple values for an option
#      --rg:
#        - CN:SequencingCenterNameHere
#        - DS:DescriptionOfReadGroup

  # Command-line options for mapDamage; use long-form options(--length not -l):
  #mapDamage:
    # By default, the pipeline will downsample the input to 100k hits
    # when running mapDamage; remove to use all hits
  #  --downsample: 100000

  # Set to 'yes' exclude a type of trimmed reads from alignment / analysis;
  # possible read-types reflect the output of AdapterRemoval
  ExcludeReads:
    # Exclude single-end reads (yes / no)?
    Single: no
    # Exclude non-collapsed paired-end reads (yes / no)?
    Paired: no
    # Exclude paired-end reads for which the mate was discarded (yes / no)?
    Singleton: no
    # Exclude overlapping paired-ended reads collapsed into a single sequence
    # by AdapterRemoval (yes / no)?
    Collapsed: no
    # Like 'Collapsed', but only for collapsed reads truncated due to the
    # presence of ambiguous or low quality bases at read termini (yes / no).
    CollapsedTruncated: no

  # Optional steps to perform during processing.
  Features:
    # If set to 'filter', PCR duplicates are removed from the output files; if set to
    # 'mark', PCR duplicates are flagged with bit 0x400, and not removed from the
    # output files; if set to 'no', the reads are assumed to not have been amplified.
    PCRDuplicates: filter
    # Set to 'no' to disable mapDamage; set to 'plots' to build basic mapDamage plots;
    # set to 'model' to build plots and post-mortem damage models; and set to 'rescale'
    # to build plots, models, and BAMs with rescaled quality scores. All analyses are
    # carried out per library.
    mapDamage: plot
    # Generate coverage information for the final BAM and for each 'RegionsOfInterest'
    # specified in 'Prefixes' (yes / no).
    Coverage: yes
    # Generate histograms of number of sites with a given read-depth, from 0 to 200,
    # for each BAM and for each 'RegionsOfInterest' specified in 'Prefixes' (yes / no).
    Depths: yes
    # Generate summary table for each target (yes / no)
    Summary: yes

# Map of prefixes by name, each having a Path key, which specifies the
# location of the BWA/Bowtie2 index, and optional label, and an option
# set of regions for which additional statistics are produced.
Prefixes:
  # Uncomment and replace 'NAME_OF_PREFIX' with name of the prefix; this name
  # is used in summary statistics and as part of output filenames.
  GCF_005190385:
    # Uncomment and replace 'PATH_TO_PREFIX' with the path to .fasta file
    # containing the references against which reads are to be mapped.
    Path: /groups/hologenomics/ariglesi/data/Narwhal/References/GCF_005190385.1_NGI_Narwhal_1_genomic.fasta

ARIdbtusk:
  ARIdbtusk:
    Lib_1:
      202205_nova: /shared/volume/hologenomics/data/mlouis/Narwhal/data/sexing/ARIDoubletusk_EKDL210009388-1a-9-AK41320_HTV5MDSX2_L2_1.fq.gz

N1196:
  N1196:
    Lib_1:
      202205_nova: /shared/volume/hologenomics/data/mlouis/Narwhal/data/sexing/SCR_037_EKDL220005416-1a-AK2123-AK3587_HK5GMDSX3_L2_1.fq.gz

N1197:
  N1197:
    Lib_1:
      202205_nova: /shared/volume/hologenomics/data/mlouis/Narwhal/data/sexing/SCR_038_EKDL220005416-1a-AK1073-AK35506_HK5GMDSX3_L2_1.fq.gz